Inhibition of integrin 5 1 ameliorates VEGF induced

Inhibition Of Integrin 5 1 Ameliorates Vegf Induced-PDF Download

  • Date:28 May 2020
  • Views:25
  • Downloads:0
  • Pages:11
  • Size:9.77 MB

Share Pdf : Inhibition Of Integrin 5 1 Ameliorates Vegf Induced

Download and Preview : Inhibition Of Integrin 5 1 Ameliorates Vegf Induced


Report CopyRight/DMCA Form For : Inhibition Of Integrin 5 1 Ameliorates Vegf Induced


Transcription:

952 Graefes Arch Clin Exp Ophthalmol 2018 256 951 961. understanding the molecular mechanisms underlying the Santa Cruz CA USA cleaved IL 1 Millipore Billerica. regulation of RNV is required for the development of safe MA USA integrin 1 cleaved caspase 1 Abcam. and effective antiangiogenic therapies Integrins a family Cambridge MA USA actin Cell Signaling Technology. of enzymatically inactive cell adhesion receptors consist Inc Danvers MA Secondary antibodies Cell Signaling. of 19 different subunits and 8 different subunits Te c h n o l o g y I n c D a n v e r s M A A n t i m o u s e. Thus far these subunits form at least 25 different integrins CD31 PECAM 1 PE eBioscience Inc San Diego CA. with distinct ligand binding specificities 8 and play sig goat anti rabbit immunoglobulin IgG fluorescein isothiocy. nificant roles in both cell cell and cell extracellular matrix anate FITC Santa Cruz Biotechnology All cell culture. interactions and modulate various signaling pathways in reagents were bought from Invitrogen Carlsbad CA USA. volving cell adhesion migration differentiation and an. giogenesis 9 10 Integrin 5 1 is a specific receptor of Animals. fibronectin 9 Both integrin 5 1 and fibronectin are. upregulated in growth factor induced NV 11 whereas Tet opsin VEGF mice were kindly provided by Professor. the expression of integrin 5 1 is low in quiescent vas Peter Campochiaro Johns Hopkins Hospital Baltimore. cular cells 11 12 Prior research showed that integrin MD 19 These double transgenic mice were completely. 5 1 inhibition by ATN 161 significantly decreased cho normal until they were given a 2 mg mL dosage of doxy. roidal neovascularization CNV leakage and the size of cycline in their drinking water to stimulate human. laser induced lesions 13 However the precise mecha VEGF165 expression in photoreceptors resulting in severe. nism by which ATN 161 ameliorates RNV remains NV and significant leakage leading to total exudative ret. unclear inal detachment in 80 90 of mice within 5 days 19. Apart from ischemia and hypoxia inflammatory reactions 20 The severe phenotype of retinal detachment has prov. also play an important role in RNV 2 The NACHT LRR en extremely useful to test efficacy of treatments 20 In. and PYD domains containing protein 3 NLRP3 formerly this study all the mice used were specific pathogen free. known as cryopyrin NALP3 is one member of the NOD Animal care and all procedures were carried out on the. like receptor NLR protein family 14 15 Upon activation basis of the Health Guide for Care and Use of Laboratory. NALP3 and adaptor protein apoptosis associated speck like Animals National Institutes the Scientific Investigation. protein containing a CARD ASC assemble a protein com Board approval SYXK 2003 0026 Shanghai Jiao Tong. plex known as NALP3 inflammasome 16 The assembled University School of Medicine Shanghai China. inflammasome triggers protease caspase 1 which then. cleaves and produces proinflammatory cytokines interleukin Quantitative reverse transcription polymerase chain. 1 IL 1 and IL 18 from their inactive precursor forms reaction RT PCR. 14 Several reports have demonstrated that the activation of. NLRP3 inflammasome is drawn into the inflammatory injury RNA was extracted from retinas and human retinal endothelial. of retinal ischemia 17 18 These data suggest that NLRP3 cells HRECs samples in accordance with the manufacturer s. inflammasome may play a key role in RNV protocols Assessing RNA quality and quantity we chose. In this study we aimed to determine the effect and under 2 g of RNA to reverse transcribe and then obtained comple. lying mechanism after inhibiting integrin 5 1 by ATN 161 mentary DNA cDNA The cDNA was used for quantitative. in Tet opsin VEGF transgenic mice which highly express RT PCR with the iQ SYBR Green mix Roche Basel. VEGF in photoreceptors resulting in severe NV and signifi Switzerland on an ABI 7500 Real time PCR system. cant leakage causing total exudative retinal detachment in 80 Applied Biosystems CA USA Primers used included. to 90 of mice after treatment with doxycycline 19 20 mouse integrin 5 forward 5 CGTTGAGTCATTCG. These studies may enable us to understand the molecular CCTCTGG 3 reverse 5 GTGCCCGCTCTTCCCTGTC. mechanisms of regulating RNV and lead to new potential 3 2 1 m o u s e i n t e g r i n 1 f orw a rd 5 TG G A. pharmacotherapy in addition to anti VEGF treatments for fu A A AT T C T G C G A G T G T G 3 r e v e r s e 5 G C AT. ture antiangiogenic therapies TCACAAACACGACACC 3 mouse NLRP3 forward 5. TCCTGGTGACTTTGTATATGCGT 3 reverse 5 TTCT,CGGGCGGGTAATCTTC 3 mouse ASC forward 5. Materials and methods GCTGAGCAGCTGCAAACGA 3 reverse 5 ACTT. CTGTGACCCTGGCAATGA 3 22 mouse caspase 1, Reagents forward 5 TGCCTGGTCTTGTGACTTGGA 3 reverse. 5 CCTATCAGCAGTGGGCATCTGTA 3 22 mouse, ATN 161 Qiangyao St Louis MO and China Primary an IL 1 forward 5 TGCCACCTTTTGACAGTGATG 3 re. tibody integrin 5 NLRP3 ASC Santa Cruz Biotechnology verse 5 AAGGTCCACGGGAAAGACAC 3 23 mouse. Graefes Arch Clin Exp Ophthalmol 2018 256 951 961 953. F i g 1 Ex p res si on le ve ls of i nt eg rin 5 1 e xam in ed by determined 2 CT method was used to calculate the relative fold. immunofluorescent staining RT PCR and western blot assays in retinas change Western blot assays were conducted to evaluate the protein. from Tet opsin VEGF transgenic mice Eyes were collected after 5 days expression of integrin 5 1 in DOX and DOX mice e n 3. of treatment with doxycycline DOX or normal treatment DOX The Relative protein expression levels of integrin 5 and integrin 1. frozen sections were immunofluorescently stained with integrin 5 a or normalized to actin are shown in f and g All data are shown as mean. integrin 1 b and CD31 a marker for VEC Each positive area was SEM from three independent experiments Student t test were used to. marked with arrowhead Total RNA of retinas was isolated and mRNA carry out statistical analysis. expression of integrin 5 c n 8 and integrin 1 d n 8 was. cyclophilin A forward 5 CAGACGCCACTGTCGCTTT Western blot analysis. 3 reverse 5 TGTCTTTGGAACTTTGTCTGCAA 3, 23 human NLRP3 forward 5 CTTCAGGTGTTGGA Proteins from retinas and cell lysate were loaded onto 8 or. ATTAGAC 3 reverse 5 GCACTTCACAGAACATCAT 12 sodium dodecyl sulfate SDS polyacrylamide gel elec. 3 24 human ASC forward 5 TTGGACCTCACCGA trophoresis and then transferred to polyvinylidinedifluoride. CAAGC 3 reverse 5 TATAAAGTGCAGGCCCTGGTG membranes Millipore These blots were incubated with. 3 human caspase 1 forward 5 GGACAAGTCAAGCC primary antibodies against integrin 5 integrin 1. GCACA 3 reverse 5 CATGTCCGAAGCAGTGAGAT NLRP3 ASC cleaved caspase 1 cleaved IL 1 and. 3 25 human IL 1 forward 5 TGCCACCTTTTGAC actin overnight at 4 C after 5 non fat milk Next these. AGTGATG 3 reverse 5 CCTATCAGCAGTGGGCATCT blots were incubated with horseradish peroxidase HRP. GTA 3 24 and human GAPDH forward 5 GGGA conjugated secondary antibodies for 1 h An enhanced. A A C T G T G G C G T G AT 3 r e v e r s e 5 G A G T chemiluminescence kit ECL Millipore was used to visu. GGGTGTCGCTGTTGA 3 alize these immunoreactive bands. 954 Graefes Arch Clin Exp Ophthalmol 2018 256 951 961. Fig 2 Influence of ATN 161 on,integrin 5 1 expression in.
retinas from adult Tet opsin,VEGF transgenic mice with. doxycycline treatment Adult,mice were intravitreously injected. with 1 L of ATN 161 in one eye,with different concentrations 0 1. 1 and 10 g L and PBS in the,other one a Integrin 5 and. integrin 1 expression levels,were detected by western blot.
assay n 3 b c Quantification,of the intensity of target protein. bands normalized relative to,actin Three independent. experiments were conducted for,statistical analysis mean SEM. and Student Newman Keuls,SNK was used to perform,statistical analysis for multiple. comparisons P 0 01, Frozen section analysis or in combination with 10 M ATN 161 for 24 h After.
washing with PBS the HRECs were fixed in 4 parafor. The eyes from Tet opsin VEGF transgenic mice were harvest maldehyde and then permeabilized in 0 5 Triton X 100. ed carefully avoiding artificial retinal detachment after 5 days Subsequently the HRECs were blocked in 5 bovine. treated with doxycycline frozen in the Tissue Tek OCT me serum albumin and incubated in anti NLRP3 or ASC an. dia prepared into 10 m thick slices from the cornea to the tibody Santa Cruz followed by incubation in the FITC. optic nerve The images were photographed with an optical anti rabbit IgG antibody Invitrogen After incubation of. microscope The retinal detachment state of the slices around 5 min in DAPI the cell samples were examined under a. the optic nerve was examined for total retinal detachment fluorescence microscope and the images were acquired. TRD partial retinal detachment PRD or no retinal detach. ment no RD 26 Cell culture and stimulation, Immunofluorescence staining The culture conditions of HRECs ScienCell included an at. mosphere containing 5 CO2 humidified 37 C endothe, The eyes from adult Tet opsin VEGF transgenic mice lial cell medium supplemented with 100 U mL penicillin. were prepared into 10 m thick slices These sections streptomycin 5 fetal bovine serum 2 The cells were in. were fixed with 4 paraformaldehyde at room tempera cubated in media with 20 ng mL VEGF with or without. ture and then rinsed in phosphate buffered saline PBS 10 M ATN 161 for 12 h to detect NLRP3 ASC caspase. After incubation in 0 5 TritonX 100 the sections were 1 IL 1 mRNA expression by RT PCR and for 24 h to detect. incubated in 5 bovine serum albumin incubated with protein expression by western blot assay and immunofluores. polyclonal rabbit anti mouse integrin 5 integrin 1 cence staining. NLRP3 or ASC antibody Santa Cruz Biotechnology, and then incubated in the mixture of FITC anti rabbit Statistical analysis. IgG antibody Cell Signaling Technology and anti, mouse CD31 PECAM 1 PE eBioscience After 5 min Classification data analysis used the chi square test Multiple. of incubation in 4 6 diamidino 2 phenylindole DAPI comparisons used Student Newman Keuls method The dif. the sections were photographed with a fluorescence mi ferences between two groups adopted the two tailed Student s. croscope The HRECs were cultured on the cell culture t test All the statistical analyses were shown using SAS 9 0. slide Millipore and treated with 20 ng mL VEGF alone software SAS Institute Inc Cary NC USA All data are. Graefes Arch Clin Exp Ophthalmol 2018 256 951 961 955. Fig 3 Influence of ATN 161 on,retinal detachment in adult Tet.
opsin VEGF transgenic mice,treated with doxycycline Tet. opsin VEGF mice were,intravitreously injected with PBS. 1 L a n 36 in one eye and,ATN 161 1 L of 1 g L b,n 34 in the other eye After. 5 days of doxycycline treatment,of drinking water the state of. retinal detachment was examined,under an optical microscope for.
total retinal detachment TRD,partial retinal detachment PRD. or no retinal detachment no RD,Chi square test was used to. analyze data c mean SEM,P 0 05 The table in d showed. the percentage of various retinal,detachment types. performed as mean values standard error of mean SEM A staining showed that integrin 5 and 1 expression. value of P 0 05 was deemed to be statistically significant levels in Tet opsin VEGF transgenic mice with doxycy. cline treatment were even higher and the merged images. showed that integrin 5 and integrin 1were mostly lo. Results calized in vascular endothelial cells VECs Fig 1a b. These findings indicate that integrin 5 1 may be main. Integrin 5 1 expression was increased in adult ly derived from RNV endothelial cells and play a signif. Tet opsin VEGF transgenic mice treated icant role in the retinal detachment of Tet opsin VEGF. with doxycycline mice, After 5 days of treatment with doxycycline mRNA ex ATN 161 inhibited integrin 5 1 expression in adult.
pression of integrin 5 was not elevated significantly Tet opsin VEGF transgenic mice treated. Fig 1c P 0 462 whereas protein expression was in with doxycycline. creased significantly Fig 1f P 0 001 Both mRNA, and protein expression of integrin 1 were elevated sig The intravitreal injection of ATN 161 followed the de. nificantly compared with controls Fig 1d P 0 001 signed concentration gradient 0 0 1 1 and 10 g L to. Fig 1g P 0 002 The results of immunofluorescence determine the lowest effective dosage in adult Tet opsin. 956 Graefes Arch Clin Exp Ophthalmol 2018 256 951 961. Fig 4 NLRP3 inflammasome,expression levels were detected in. retinas from Tet opsin VEGF,transgenic mice Total RNA of. retinas was isolated and the,mRNA expression levels of. NLRP3 a n 6 ASC b n 8,caspase 1 c n 8 and IL 1 d,n 8 were detected by real time.
RT PCR in DOX and DOX,mice 2 CT method was used to. count up the relative fold change,Protein expression levels of. NLRP3 e n 3 ASC f n 3,cleaved caspase 1 g n 3 and,cleaved IL 1 h n 3 were. determined using western blot,assays All data are shown as. mean SEM from three,independent experiments,Student s t test was used to carry.
out statistical analysis,Immunofluorescent staining of. ocular frozen sections was used to,test expression of NLRP3 ASC. and CD31 i Each positive area,was marked with arrowhead. VEGF transgenic mice with doxycycline treatment The that integrin 5 1 plays a supportive part in retinal detach. analysis of western blot results revealed that ATN 161 sig ment in Tet op. Inhibition of integrin 5 1 ameliorates VEGF induced retinal neovascularization and leakage by suppressing NLRP3 inflammasome signaling in a mouse model AilingSui1 amp Yisheng Zhong1 amp AnnaM Demetriades2 amp QingLu1 amp YujuanCai1 amp YushuoGao1 amp Yanji Zhu1 amp Xi Shen1 amp Bing Xie1 Received 18 October 2017 Revised 3 February 2018 Accepted 19 February 2018 Published onl

Related Books