Basics of Signals and Systems Universit degli Studi di

Basics Of Signals And Systems Universit Degli Studi Di-PDF Download

  • Date:29 Jul 2020
  • Views:9
  • Downloads:0
  • Pages:81
  • Size:2.65 MB

Share Pdf : Basics Of Signals And Systems Universit Degli Studi Di

Download and Preview : Basics Of Signals And Systems Universit Degli Studi Di


Report CopyRight/DMCA Form For : Basics Of Signals And Systems Universit Degli Studi Di


Transcription:

Didactic material, Signal Processing and Linear Systems B P Lathi CRC Press. Other books, Signals and Systems Richard Baraniuk s lecture notes available on line. Digital Signal Processing 4th Edition Hardcover John G Proakis Dimitris K. Teoria dei segnali analogici M Luise G M Vitetta A A D Amico McGraw Hill. Signal processing and linear systems Schaun s outline of digital signal. processing,All textbooks are available at the library. Handwritten notes will be available on demand,Gloria Menegaz 2. Signals Systems,Input signal Output signal,amplitude Linear time invariant amplitude.
systems LTIS,LTIS perform any kind,of processing on the. input data to generate,output data,Gloria Menegaz 3. Signals Systems, Signal classification and Linear Time Invariant Systems. representation Time and frequency domain analysis,Types of signals Impulse response. Sampling theory Stability criteria,Quantization,Digital filters.
Signal analysis Finite Impulse Response FIR,Fourier Transform Mathematical tools. Continuous time Fourier series, Discrete Time Fourier Transforms Laplace Transform. Windowed FT Basics,Spectral Analysis Z Transform,Applications in the domain of Bioinformatics. Gloria Menegaz 4,What is a signal,A signal is a set of information of data. Any kind of physical variable subject to variations represents a signal. Both the independent variable and the physical variable can be either scalars or. Independent variable time t space x x x1 x2 x x1 x2 x3. Electrochardiography signal EEG 1D voice 1D music 1D. Images 2D video sequences 2D time volumetric data 3D. Gloria Menegaz 5,Example 1D biological signals ECG.
Gloria Menegaz 6,Example 1D biological signals EEG. Gloria Menegaz 7,1D biological signals DNA sequencing. GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATG,Gloria Menegaz 8. Example 2D biological signals MI,Gloria Menegaz 9,Example 2D biological signals microarrays. Gloria Menegaz 10,Signals as functions, Continuous functions of real independent variables.
2D f f x y x y,Real world signals audio ECG images. Real valued functions of discrete variables,2D f f i j. Sampled signals,Discrete functions of discrete variables. 1D fd fd k,2D fd fd i j,Sampled and quantized signals. Gloria Menegaz 11,Images as functions,Gray scale images 2D functions.
Domain of the functions set of x y values for which f x y is defined 2D lattice. i j defining the pixel locations,Set of values taken by the function gray levels. Digital images can be seen as functions defined over a discrete domain i j. 0 i I 0 j J, I J number of rows columns of the matrix corresponding to the image. f f i j gray level in position i j,Gloria Menegaz 12. Example 1 function,0 i j 0 i j,0 otherwise,Gloria Menegaz 13. Example 2 Gaussian,Continuous function,Discrete version.
Gloria Menegaz 14,Example 3 Natural image,Gloria Menegaz 15. Basics of Signals and Systems Gloria Menegaz AA 2011 2012 1 Gloria Menegaz Didactic materia l Textbook Signal Processing and Linear Systems B P Lathi CRC Press Other books Signals and Systems Richard Baraniuk s lecture notes available on line Digital Signal Processing 4th Edition Hardcover John G Proakis Dimitris K Manolakis Teoria dei segnali analogici

Related Books