Arun M Z Reel B Sala Newby G B Bond M

Arun M Z Reel B Sala Newby G B Bond M-PDF Download

  • Date:30 Jul 2020
  • Views:9
  • Downloads:0
  • Pages:9
  • Size:1.17 MB

Share Pdf : Arun M Z Reel B Sala Newby G B Bond M

Download and Preview : Arun M Z Reel B Sala Newby G B Bond M


Report CopyRight/DMCA Form For : Arun M Z Reel B Sala Newby G B Bond M


Transcription:

Drug Design Development and Therapy Dovepress,open access to scientific and medical research. Open Access Full Text Article Original Research,Zoledronate upregulates MMP 9 and 13 in. rat vascular smooth muscle cells by inducing,oxidative stress. This article was published in the following Dove Press journal. Drug Design Development and Therapy,18 April 2016,Number of times this article has been viewed. Mehmet Zuhuri Arun 1 Background Bisphosphonates including zoledronate target osteoclasts and are widely used in. Buket Reel 1 the treatment of osteoporosis and other bone resorption diseases despite side effects that include. Graciela B Sala Newby 2 damaging the stomach epithelium Beneficial and adverse effects on other organ systems including. Mark Bond 2 the cardiovascular system have also been described and could impact on the use of bisphospho. Aikaterini Tsaousi 2 nates as therapeutic agents Vascular smooth muscle cells VSMCs are major constituents of. the normal vascular wall and have a key role in intimal thickening and atherosclerosis in part by. Perry Maskell 2, secreting MMPs that remodel the extracellular matrix and cleave cell surface proteins or secreted.
Andrew C Newby 2, mediators In this study we investigated the effects of zoledronate on MMP expression. Department of Pharmacology Faculty Methods Rat VSMCs were stimulated by PDGF 50 ng mL plus TNF 10 ng mL or left. of Pharmacy Ege University Izmir, Turkey 2Bristol Heart Institute unstimulated for a further 24 hours in serum free medium In other series of experiments cells. University of Bristol Bristol Royal were pre treated either with SC 514 50 M or with apocynin 20 nM for 2 hours then zole. Infirmary Bristol UK, dronate 100 M was added into 2 fetal calf serum containing medium for 24 hours. Results and discussion Using isolated rat VSMCs in culture zoledronate 100 M increased. MMP 9 and 13 mRNA expressions but inhibited MMP 2 expression MMP 9 and MMP 13. up regulation was shown to depend on the NF B pathway and this was activated by zole. dronate Furthermore zoledronate elevated the levels of reactive oxygen species detected by. either dichlorofluorescein in isolated VSMCs or lucigenin enhanced chemiluminescence in rat. aortic rings in vitro Apocynin an inhibitor of NADPH oxidase reversed NF B activation and. MMP 9 and MMP 13 up regulation by zoledronate, Conclusion We conclude that zoledronate increases MMP 9 and MMP 13 expressions in rat. VSMCs dependent upon stimulation of the NF B pathway by reactive oxygen species Effects. on MMP expression may contribute to the pharmacologic profile of bisphosphonates. Keywords vascular smooth muscle cell matrix metalloproteinase bisphosphonate reactive. oxygen species zoledronate,Introduction, Bisphosphonates are widely used clinically for the treatment of osteoporosis and bone.
metastasis Although they primarily target osteoclasts adverse and beneficial effects. on other organ systems have been described Destruction of the gastric epithelium. by high concentrations of bisphosphonates is a recognized off target effect On the. Correspondence Mehmet Zuhuri Arun contrary beneficial effects on atherosclerosis have also been described 1 3 although. Department of Pharmacology,Faculty of Pharmacy Ege University. the precise mechanisms involved have not been elucidated. 35100 Bornova Izmir Turkey Migration and proliferation of vascular smooth muscle cells VSMCs play key. Tel 90 232 311 3288,Fax 90 232 388 4687, roles in the development of vascular proliferative diseases such as atherosclerosis and. Email mehmet arun ege edu tr restenosis 4 Moreover previous studies showed that bisphosphonates inhibit adhesion of. submit your manuscript www dovepress com Drug Design Development and Therapy 2016 10 1453 1460 1453. Dovepress 2016 Arun et al This work is published and licensed by Dove Medical Press Limited The full terms of this license are available at https www dovepress com terms php. http dx doi org 10 2147 DDDT S103124, and incorporate the Creative Commons Attribution Non Commercial unported v3 0 License http creativecommons org licenses by nc 3 0 By accessing the work you. hereby accept the Terms Non commercial uses of the work are permitted without any further permission from Dove Medical Press Limited provided the work is properly attributed For permission. for commercial use of this work please see paragraphs 4 2 and 5 of our Terms https www dovepress com terms php. Arun et al Dovepress, VSMCs to extracellular matrix components in tissue culture interfering with the zymographic assays and were well toler. as well as their proliferation and migration 5 6 The end result is ated by VSMCs 16. decreased neointimal hyperplasia both in preclinical and clini. cal investigations 7 9 MMPs play a variety of roles in normal Treatment of the cells. vascular physiology and pathology For example increased Zoledronate Novartis International AG Basel Switzerland. expression of MMP 13 especially in rodents can degrade was obtained as a 2 94 mM sterile neutral aqueous solution. fibrillar type I and III collagen thereby increasing atheroscle for intravenous infusion containing 4 mg of zoledronate. rotic plaque s vulnerability to rupture 10 Conversely MMP 2 220 mg mannitol and 24 mg sodium citrate in 5 mL Cells. and MMP 9 stimulate migration and proliferation of VSMCs were seeded into 12 well plates When they became conflu. by degrading basement components including type IV collagen ent they were pre treated with zoledronate to a final concen. This contributes to restenosis but may prevent plaque rupture tration of 100 M zoledronate or kept as untreated in 2 FCS. thanks to formation of a more stable plaque cap 11 containing medium for 24 hours Given the high dilution and. Bisphosphonates have been reported to inhibit expres innocuous nature of the vehicle untreated cells were used. sion and activity of some MMPs in different steps of cancer as a control Cells were stimulated by PDGF 50 ng mL. progression 12 14 However the effects of bisphosphonates plus TNF 10 ng mL or left unstimulated for a further. on MMPs implicated in the pathogenesis of atherosclerosis 24 hours in serum free medium In other series of experi. and restenosis have not been elucidated In this study we ments cells were pre treated either with SC 514 Cayman. therefore investigated the effects of zoledronate which is Chemicals MA USA 50 M 17 or with apocynin 20 nM. a highly potent bisphosphonate on MMP 2 MMP 9 and for 2 hours then zoledronate 100 M was added into 2. MMP 13 expressions in rat VSMCs FCS containing medium for 24 hours. Materials and methods Real time polymerase chain reaction. Cell culture PCR analysis, Primary rat cells Total RNA were extracted from VSMCs using the total RNA.
Male Sprague Dawley rats were killed by cervical dislocation extraction kit Ambion Thermo Fisher Scientific Waltham. in accordance with the Directive 2010 63 EU of the European MA USA according to the manufacturer s instructions. Parliament Approval was granted by the University of Bristol Extracted RNA was quantified using Nanodrop 1000. ethical review board VSMCs four separate preparations from Spectrophotometer Thermo Fisher Scientific and reverse. different rats were obtained by the explant method from tho transcribed using a Roche Reverse Transcription Kit. racic aortas and were cultured in Dulbecco s Modified Eagle s Hoffman La Roche Ltd Basel Switzerland 100 ng RNA. Medium Lonza Basel Switzerland containing 10 fetal calf per reaction A genomic DNA removal step was included. serum FCS penicillin 100 mg mL streptomycin 100 U and the resulting cDNA was diluted in 10 mM Tris HCl. mL and L glutamine 2 mM VSMCs were used between pH 8 Real time quantitative PCR was performed in Illumina. passage 6 and 8 in the experiments which is within the limits Eco Real Time PCR with Roche SYBR Green Master Mix. passage 3 8 of previous studies 15 Reduced serum 2 or and primers for MMP 2 MMP 9 MMP 13 I B and 36B4. serum free conditions were used in some incubations to avoid which is a housekeeping gene Primers are listed in Table 1. Table 1 Primer sequences used for real time polymerase chain reaction. Gene symbol Accession number Primer sequences,MMP 2 NM 031054 F GGGAGCGCAAGGATGGAGGCACGA. R CCAGCAGGCAGCACAGGACGCAGA,MMP 9 NM 031055 F AGGCGCCGTGGTCCCCACTTACTT. R GCAGGGTTTGCCGTCTCCGTTGCC,MMP 13 NM 133530 F TCGCATTGTGAGAGTCATGCCAACA. R TGTGGTTCCAGCCACGCATAGTCA,I B NM 001105720 F CTACTGGACGACCGCCACGACAGC. R CGAGGCGGATCTCCTGCAGCTCCTTG,36B4 NM 022402 F GCCAGCGAAGCCACGCTGCTGAAC.
Note National Center for Biotechnology Information accession number gene symbol and sequences of forward F and reverse R primers. 1454 submit your manuscript www dovepress com Drug Design Development and Therapy 2016 10. Dovepress Effect of zoledronate on MMPs in rat VSMCs. To confirm amplification specificity PCR products from with the Guide for the Care and Use of Laboratory Animals. each primer pair were subjected to agarose gel electro prepared by the Institute of Laboratory Animal Resources. phoresis Relative mRNA expression levels were calcu Levels of superoxide anion and other ROS in aortic rings. lated by using the Delta Delta Ct method using 36B4 as a were measured as previously described 19 In this study Wistar. normalization control rats were euthanized by decapitation under ketamine xylazine. anesthesia The thoracic aorta segment was dissected Fol. Western blotting and gelatin zymography lowing careful removal of loose connective tissue thoracic. Conditioned media of the cells were collected and con aorta was cut into 2 mm rings The rings were then transferred. centrated using centrifugal filter units Merck Millipore into Dulbecco s Modified Eagle s Medium F12 Gibco. Billerica MA USA Cells were lysed in sodium dodecyl Thermo Fisher Scientific cell culture medium containing 2. sulfate SDS buffer 2 SDS w v 16 glycerol v v FCS immediately The rings were incubated in cell culture. and 50 mM Tris pH 6 8 Protein concentration in lysates medium in the presence or absence of 100 M zoledronate. was measured using BCA Protein Assay Kit Thermo Fisher for 24 hours in a humidified atmosphere containing 5. Scientific and was used to normalize loading of gels CO2 at 37 C Subsequently aortic rings were transferred. MMP 9 activity in conditioned medium was determined to solid white well plates containing 200 mL of HEPES. by gelatin zymography as described previously 17 Briefly buffered Krebs Henseleit solution pH 7 4 After addition. 7 5 polyacrylamide gels containing 2 mg mL of gelatin were of chemiluminescence enhancers lucigenin or luminol final. subjected to electrophoresis Following electrophoresis SDS concentration of 5 mol L for either ROS were quantified. was removed by washing in 2 5 Triton X 100 Gels then using a multi plate reader Victor III 1420 PerkinElmer. were incubated at 37 C for 48 hours in incubation buffer 50 Inc Waltham MA USA Counts were obtained every 10. mM Tris HCl pH 8 0 50 mM NaCl 10 mM CaCl2 and 0 05 seconds and normalized per mg of wet tissue weight Results. Triton X 100 Ethylenediaminetetraacetic acid EDTA were expressed as the area under curve for a counting period. inhibits MMP activity by chelating Zn2 on enzymes catalytic of 5 minutes of relative light units rlu wet tissue mg. domain In order to verify if the detected bands were MMP 2. and 9 another gel was incubated in calcium free incubation Statistical analysis. solution containing 10 mM EDTA After the incubation Statistical analyses were performed using the Prism software. period gels were stained in 0 2 Coomassie Brilliant Blue v 4 GraphPad Software Inc La Jolla CA USA Multiple. Images of the gels were captured with a scanner Gelatinase comparisons were subjected to one way analysis of variance. activity was detected as clear bands on dark backgrounds followed by post hoc Bonferroni correction Paired Student s. For Western blotting equal total protein concentrations t tests were performed to compare means of lucigenin. see above were loaded on 8 10 polyacrylamide gels luminol measurements When necessary data were normal. and transferred onto polyvinylidene difluoride membranes as ized by log transformation Normalized data were expressed. described previously 18 These were blocked for an hour in 5 as mean standard error of the mean P 0 05 was considered. w v skimmed milk powder and incubated overnight at 4 C statistically significant. with anti MMP 13 catalog no ab39012 Abcam Cambridge. UK 1 2 000 in 5 BSA Tris buffered saline Bound pri Results. mary antibodies were detected by horseradish peroxidase Effects of zoledronate on expression of. conjugated antibodies Sigma Aldrich Co St Louis MO MMPs with and without induction by. USA catalog no A6154 1 5 000 in 5 BSA Tris buffered PDGF and TNF. saline and enhanced chemiluminescence Amersham Inter Because of their diverse roles and regulation patterns we stud. national Buckinghamshire UK ied constitutively expressed gelatinase MMP 2 together with. another gelatinase MMP 9 and a collagenase MMP 13 that. Detection of reactive oxygen species could be induced by a combination of PDGF and TNF. ROS in rat thoracic aortic rings, This study was approved by the Local Ethics Committee of Gelatinase A MMP 2. Dokuz Eylul University School of Medicine All animals received MMP 2 was constitutively expressed in VSMCs Figure 1A B. care in compliance with the principles of laboratory animal care in agreement with previous studies 16 Zoledronate pre treat. formulated by the National Society for Medical Research and ment did not change constitutive MMP 2 mRNA levels. Arun M Z Reel B Sala Newby G B Bond M Tsaousi A Maskell P amp Newby A C 2016 Zoledronate upregulates MMP 9 and 13 in rat vascular smooth

Related Books